Class 12 Biology Case Study Questions

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard.

Class 12 Biology Case Study Questions

Class 12 Biology Case Study Questions

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers, you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23, CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

1. What is the objective of this action?
2. Explain how the gene of interest is introduced into a vector.
3. You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
4. A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

1. estrogen
2. progesterone
3. luteinizing hormone
4. follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

1. estrogen
2. progesterone
3. luteinizing hormone
4. follicle stimulating hormone

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

1. Peak of Hormone B will be observed at a higher point in the graph
2. Peak of Hormone B will be observed at a point lower than what is given in the graph
3. There will be no observed data for Hormone B
4. The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

1. Corpus Luteum
2. Tertiary follicle
3. Graafian follicle
4. Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

1. 28 days
2. 42 days
3. 180 days
4. 280 days

Which of the following statements is true about the subjects?

1. Subject 1 is pregnant
2. Subject 2 is pregnant
3. Both subject 1 and 2 are pregnant
4. Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

1. Which of the following organisms is used in the production of beverages?
   1. Penicillium notatum
   2. Saccharomyces cerevisiae
   3. Aspergillus niger
   4. Clostridium butylicum
2. Microbes are present in
   1. soil
   2. thermal vents
   3. polluted water
   4. all of these
3. Saccharomyces cerevisiae is used primarily for
   1. Baking
   2. Bleaching
   3. Biofuel
   4. None of the above
4. The large holes in ‘Swiss cheese’ are due to
   1. production of a large amount of CO₂
   2. production of O₂
   3. due to the presence of water
   4. none of these
5. Assertion- Lactic acid bacteria (LAB) grow in milk and convert it to curd.
   Reason- It produces acids that coagulate and partially digest the milk proteins.
   1. Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
   2. Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
   3. Our Assertion is true but the Reason is false
   4. Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.